Biology Exam

AGA codon is a signal stop polypeptide synthesis in human mitochondria

Cricks Wobble hypothesis describes pairing between:

Point the false sentence concerning eukaryotic transcription:

Which of RNA Poll II modifications is required for activation of preiniation complex

Post transcriptional processing of pre- mRNA in eukaryotic includes attachment of:

The RNA polymerase which appears in the nucleolus is responsible for:

The specified nucleotide sequence 3’ATGCAAGCGATCCTGGATTCACGTTA5’ occurs on one of the strands in the
replication fork. If the synthesis of a 8-nucleotide primer on the leader strand began with a selected nucleotide, its
sequence and the nucleotid with a free 3’OH end is:

Choose incorrect description of the oriC region

Telomerase is the

Replication starts at:

Molecule of insulin consist of two polypeptide chains. Knowing their sequence and assuming they were not
postranslationally processed we can:

The number of possible codons, which can bind aminoacyl- tRNA molecules is:

The structure consisting of a singe histone H1 and doubled histones H2A, H2B, and H4 wrapped around with 146
bp DNA fragment is called:

The most common type of DNA in nature is

Nitrogen bases that are a building blocks for nucleic acids are divided into two following groups

In Avery’s experiment the cells of rough pneumococcus strain were mixed with purified lysate of Pneumococcus S
strain cells. This experiment led to the conclusion that:

The main proof allowing us to say that DNA carries genetic information is that:

Animal cell DOES NOT contain chloroplast and:

Mark the true statements:

The "Flavr Savr" modification of tomatoes is for:

The following occurs in the S-phase:

Pick a false statement regarding the inheritance of mitochondrial illnesses:

Prader-Willi's syndrome is:

In the case of Cystic Fibrosis, the effects of the mutation of the Delta-508 gene is most commonly located

A woman with paracentric inversion on Chromosome 3- which genotype:

Which disease is caused by hemolytic breakdown of RBC due to ingestion of asperin and fruits(legumes) :

Which factor doesn’t cause mutations?

FISH method allows visualizing the certain DNA fragments in chromosomes because this method uses:

Chromosome of prokaryote is

The DNA sequence complementary to 5´-ACCGTGACATTG-3´ is

Which statement is NOT true about nucleic acid hybridization

Griffith´s experiment has shown that

Which of the bonding examples below is NOT possible

According the wobble hypothesis, a U in the 5´ position of the anticodon can pair with

the genetic code consisted of four bases per codon rather than three, what maximum number of unique amino acids that could be encoded would be:

The genetic code is non-overlapping. it means that

Choose the FALSE statement regarding the termination of replication in Procaryote

. The following nucleotide sequence  3´-ATGCAAGCGATCCTGGATTCACGTTA-5´  is present in the leading strand of the replication fork. If the synthesis of the 8-element olingonucleotide is following starting from marked T:

The role of SSB proteins in replication is

Replisome is a set of peroteines certributing to the replication and it contains ( among others)